Which is the "Only enzyme" that has the "Capa | vedclass

Name: Exam Paper Generator | JEE NEET Paper Generator | Vedclass
Brand: Vedclass
Rating: 5 (35 reviews)

Question

(B) In prokaryotes,the process of transcription is carried out by a single type of enzyme known as $DNA$ dependent $RNA$ polymerase.This enzyme is res

Vedclass · Accepted Answer

$DNA$ dependent $RNA$ polymerase

Vedclass · Answer

(B) In prokaryotes,the process of transcription is carried out by a single type of enzyme known as $DNA$ dependent $RNA$ polymerase.This enzyme is responsible for all three stages of transcription:$1$. Initiation: The enzyme binds to the promoter site on the $DNA$ template with the help of a sigma $(\sigma)$ factor.$2$. Elongation: The enzyme facilitates the polymerization of ribonucleotides to form the $RNA$ chain.$3$. Termination: Upon reaching the terminator sequence,the enzyme dissociates from the $DNA$ template with the help of a rho $(\rho)$ factor.Therefore,$DNA$ dependent $RNA$ polymerase is the only enzyme required for the entire process.

Which is the "Only enzyme" that has the "Capability" to catalyse initiation,elongation,and termination in the process of transcription in prokaryotes?

Similar Questions

What is the role of $RNA$ polymerase $III$ in the process of transcription in eukaryotes?

The $TATA$ box of a eukaryotic promoter lies:

Identify the correct statement:

Removal of $RNA$ polymerase $III$ from nucleoplasm will affect the synthesis of

Which one is the correct product of $DNA$ dependent $RNA$ polymerase for the given template strand?
$3'TACATGGCAAATATCCATTCA5'$

Vedclass Test Series

Exam Paper Generator

Online Exam Module